View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12547_low_5 (Length: 267)
Name: NF12547_low_5
Description: NF12547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12547_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 34825212 - 34825452
Alignment:
| Q |
11 |
cagagagaacgaaggattnnnnnnnggtaggaaacacatgtcctagtatatactttgaaataataagagctttggatccatccaggaccaagctgggaaa |
110 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34825212 |
cagagagaacgaaggattaaaaaaaggtaggaaacacatgtcctagtatatactttgaaataataagagctttggatccatccaggaccaagctgggaaa |
34825311 |
T |
|
| Q |
111 |
atcttcacacttggttcttgattttaaaatccacacccaccaatcaaacattaactgtgctgcttcatttggttccactcattgccaaaaatacacgtca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34825312 |
atcttcacacttggttcttgattttaaaatccacacccaccaatcaaacattaactgtgctgcttcatttggttccactcattgccaaaaatacacgtca |
34825411 |
T |
|
| Q |
211 |
gtggaggtggagtcagcgacataaacaccatgccatgctgt |
251 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34825412 |
gtgaaggtggagtcagcgacataaacaccatgccatgctgt |
34825452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University