View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12548_low_11 (Length: 236)
Name: NF12548_low_11
Description: NF12548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12548_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 68 - 219
Target Start/End: Complemental strand, 51110048 - 51109897
Alignment:
| Q |
68 |
catatggttagatatctttcttttaaatactaacatactcaaattgttaaataacgtatcacgatgcacttaggatttcgtgtagatgtcaaaagatgaa |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51110048 |
catatggttagatatctttcttttaaatactaacatactcaaattgttaaataacgtatcacgatgcacttaggatttcgtgtagatgtcaaaagatgaa |
51109949 |
T |
 |
| Q |
168 |
gaccatatttattattttttggttgacatttaattattatagcagtgtaaca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51109948 |
gaccatatttattattttttggttgacatttaattattatagcagtgtaaca |
51109897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 51110952 - 51110889
Alignment:
| Q |
1 |
tgatcacattttcgtagaaatatggcgggtannnnnnnctttcaggttagacatctcatttctt |
64 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
51110952 |
tgatcacattttcatagaaatatggcgggtatttttttctttcaggttagacatctcatttctt |
51110889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University