View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12549_high_4 (Length: 277)
Name: NF12549_high_4
Description: NF12549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12549_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 272
Target Start/End: Complemental strand, 49269476 - 49269221
Alignment:
| Q |
18 |
ctctgcaccaggttttaaacatattccaactcaaactgatctttccattaaaattcgatttaggagtagttcatgcaaccagtcaaaagtgttgaagctt |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49269476 |
ctctgcaccaggttttaaacacattccaactcaaactgatctttccattaaaattcgatttaggagtagttcatgcaaccagtcaaaagtgttgaagctt |
49269377 |
T |
 |
| Q |
118 |
tcaaaagagggatctgggttctggtttttgagcactggtggtgtagctggggatgttgttagtaagttcaa-attgagaagcttgaaggagacactggga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49269376 |
tcaaaagagggatctgggttctggtttttgagcactggtggtgtagctggggatgttgttagtaagttcaagattgagaagcttgaaggagacactggga |
49269277 |
T |
 |
| Q |
217 |
ttccaatctatatctttaagttctgtccttctgttcctggtgctttctgtgctcct |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49269276 |
ttccaatctatatctttaagttctgtccttctgttcctggtgctttatgtgctcct |
49269221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 101 - 201
Target Start/End: Complemental strand, 49271841 - 49271740
Alignment:
| Q |
101 |
caaaagtgttgaagctttcaaaagagggatctgggttctggtttttgagcactggtggtgtagctggggatgttgttagtaagttcaa-attgagaagct |
199 |
Q |
| |
|
||||||||| || ||||| ||| | || |||||||| |||||| ||||||||||||||| |||||||||| ||||||| |||||||| ||||||| ||| |
|
|
| T |
49271841 |
caaaagtgtggaggcttttaaaggttgggtctgggttttggtttgtgagcactggtggtgcagctggggatcttgttagcaagttcaagattgagaggct |
49271742 |
T |
 |
| Q |
200 |
tg |
201 |
Q |
| |
|
|| |
|
|
| T |
49271741 |
tg |
49271740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University