View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12549_low_7 (Length: 248)
Name: NF12549_low_7
Description: NF12549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12549_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 237
Target Start/End: Complemental strand, 50568163 - 50567942
Alignment:
| Q |
16 |
gacatcattgtttaacacgaatacacttttttgttggcatgagcaaaccacataatttgagggtttagaccatcttcaaatgcatgtctttcaatgcata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50568163 |
gacatcattgtttaacacgaatacactttttttttggcatgagcaagccacataatttgagggtttagaccatcttcaaatgcatgtctttcaatgcata |
50568064 |
T |
 |
| Q |
116 |
tatttgatgattataagtatttttgtcaannnnnnngcttttgattctaatttcagtttcttagcaactaaatttgaattagttataaaataactaacat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50568063 |
tatttgatgattataagtatttttgtcaatttttttgcttttgataataatttcagtttcttagcaactaaatttgaattagttataaaataactaacat |
50567964 |
T |
 |
| Q |
216 |
ttgaatgattttccacttcaaa |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
50567963 |
ttgaatgattttccacttcaaa |
50567942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University