View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_high_6 (Length: 547)
Name: NF1254_high_6
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_high_6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 459; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 459; E-Value: 0
Query Start/End: Original strand, 53 - 547
Target Start/End: Complemental strand, 52183572 - 52183078
Alignment:
| Q |
53 |
cagagggacacgcagacttgaacatctctgagtactgtgttggactgcaactctgtggactcgaatgttcaccggtgcaacaaaattcctcggttttaaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
52183572 |
cagagggacacgcagacttgaacatctctgagtactgtgttgaactgcaactctgtggactcgaatgttcaccggtacaacaaaattcctcggtattaaa |
52183473 |
T |
|
| Q |
153 |
cgctgcacacgcactcttacaggccaccaccgaaccccctacctctgttacctgcaactccgctggacaatgacttttcaaatctgcaacacaacctgca |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
52183472 |
cgctgcacacgcactcttacaggccaccaccgaaccccctacctctgttacctgcaactccgctggacaatgactgttcaaatccgcaacacaacctgca |
52183373 |
T |
|
| Q |
253 |
tactgacaatcacctgttcctctggttgcttgtatccctatcccgacattgtaaccatccaccaaactaacgtcatagaagtctttatctccactcacgc |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52183372 |
tactgacaatcacctgttcctctggttgcttgtatccctatcccgacattgtaaccatccaccaaactaacgtcatagaagtctttatctccactcacgc |
52183273 |
T |
|
| Q |
353 |
ttccgatcgtaaattccgccaacgtcactggaggagcacctccaccattgcatttcaatcctccagtgcagtctccggtgatgcaattcccgttacaagc |
452 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52183272 |
ttccgatcgtaaattccgccaacgtcactggaggagcacctccaccattgcatttcaatcctccggtgcagtctccggtgatgcaattcccgttaccagc |
52183173 |
T |
|
| Q |
453 |
accgtcgaagttgcagccggttctaccccagacacgtccagaccagcctggcggagcagtgacgtcaaaagacgatccttgcggcagagaaaatc |
547 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52183172 |
accgtcgaagttgcagccggttctaccccagaaacgtccagaccagcctggcggagcagtgacgtcaaaagacgatcctggcggcagagaaaatc |
52183078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 124 - 188
Target Start/End: Complemental strand, 6679231 - 6679167
Alignment:
| Q |
124 |
ccggtgcaacaaaattcctcggttttaaacgctgcacacgcactcttacaggccaccaccgaacc |
188 |
Q |
| |
|
|||||||||||||||||||| | || ||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
6679231 |
ccggtgcaacaaaattcctccatattgaacgccaaacacgcgctcttacaagccaccaccgaacc |
6679167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University