View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_high_66 (Length: 264)
Name: NF1254_high_66
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_high_66 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 6 - 236
Target Start/End: Original strand, 46501894 - 46502122
Alignment:
| Q |
6 |
tcatcaagaagttcgatcaattgtacttacgtctttgacaacatagtataaannnnnnnnattcatatattatcgtccaatttacaaatttactccgctc |
105 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46501894 |
tcatcaagaagttcgatcaattgtactcacgtctttgacaacatagtataa--tttttttattcatatattatcgtccaatttacaaatttactccgctc |
46501991 |
T |
|
| Q |
106 |
tgctacgctcgagtgtctataggcttagtaacaaatatgagtctcaagagagagcaatgtaaattttatctatgagaaagagtagttagagcattagata |
205 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46501992 |
tgctacgctcgagtgtcgataggcttagtaacaaatatgagtctcaagagagagcaatgtaaattttatctatgagaaagagtagttagagcattagata |
46502091 |
T |
|
| Q |
206 |
aaggatatgtatgcatccttatattgtactt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46502092 |
aaggatatgtatgcatccttatattgtactt |
46502122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University