View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_high_75 (Length: 251)
Name: NF1254_high_75
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_high_75 |
 | |
|
| [»] scaffold0110 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0110 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 29 - 225
Target Start/End: Complemental strand, 2418 - 2222
Alignment:
| Q |
29 |
agctttatcatcttttacttccttttttccaaagagtttagtgacataagtcacacacac--taaatgcatggagcggattgaacccacgttccactata |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2418 |
agctttatcatcttttacttccttttttccaaagagtttagtgacacaagtcacacacacactaaatgcatggagcggattgaacccacgttccactata |
2319 |
T |
|
| Q |
127 |
atcaactaatcatgcagttgttcaagatgtatgtaaccggttagtataacacactctttattggatgttgatttatttggaagtctaaaaatgatgaaa |
225 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2318 |
atcaactaaccatgcagttgttcaagatgtatgtaaccggttagtataacaca--ctttattggatgttgatttatttggaagtctaaaaatgatgaaa |
2222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 146 - 227
Target Start/End: Original strand, 17488227 - 17488311
Alignment:
| Q |
146 |
gttcaagatgtatgtaaccggttagtataacacactcttt---attggatgttgatttatttggaagtctaaaaatgatgaaact |
227 |
Q |
| |
|
|||||| ||| ||| ||| | ||||||||||||||||||| ||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
17488227 |
gttcaaaatgcatgcaactgattagtataacacactcttttttattggatgttgatttatttagaagtctagaaatgacgaaact |
17488311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University