View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_high_87 (Length: 206)
Name: NF1254_high_87
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_high_87 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 4 - 126
Target Start/End: Complemental strand, 1864806 - 1864685
Alignment:
| Q |
4 |
ttttttacaatggacatttgatttaagatataaactttatcagagactagttttgggacgtatgtttggcactcttattagtcagcagtccaacaggtaa |
103 |
Q |
| |
|
|||||||| | |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
1864806 |
ttttttacgagggacttttgatttaagatataaactttatctgagactagttttgggacgtatgtttggcactcttattagtcagcagt-caataggtaa |
1864708 |
T |
|
| Q |
104 |
catctaggaacattgatctgcct |
126 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
1864707 |
catttaggaacattgatctgcct |
1864685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University