View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1254_low_101 (Length: 229)

Name: NF1254_low_101
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1254_low_101
NF1254_low_101
[»] chr4 (2 HSPs)
chr4 (57-152)||(30519167-30519262)
chr4 (1-33)||(30519283-30519315)
[»] chr2 (1 HSPs)
chr2 (63-146)||(38897067-38897153)


Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 57 - 152
Target Start/End: Complemental strand, 30519262 - 30519167
Alignment:
57 agcaagaacaaattatgggataatcattccaaatggagatcaactttcttccaacctcatcatatgtgtcatcatacacctttgcttcttcatctc 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30519262 agcaagaacaaattatgggataatcattccaaatggagatcaactttcttccaacctcatcatatgtgtcatcatacacctttgcttcttcatctc 30519167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 30519315 - 30519283
Alignment:
1 aatatagaaaaggttattggatgaaataggatt 33  Q
    |||||||||||||||||||||||||||||||||    
30519315 aatatagaaaaggttattggatgaaataggatt 30519283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 63 - 146
Target Start/End: Complemental strand, 38897153 - 38897067
Alignment:
63 aacaaattatgggataatcattccaaatggagatcaactttcttcc----aacctcatcatatgtgtcatcatacacctttgcttctt 146  Q
    ||||||||||| |||||||||||||||||||   |||||||||| |    ||||||||||||||||||||||||||||||||| ||||    
38897153 aacaaattatgagataatcattccaaatggatg-caactttcttgctatcaacctcatcatatgtgtcatcatacacctttgcctctt 38897067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University