View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_104 (Length: 219)
Name: NF1254_low_104
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_104 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 9063805 - 9063941
Alignment:
| Q |
1 |
ttattaatgaagcctcaaaaaatggtttggctttaccatatacaccatattggtatggtttaacaataggtggaatgatcggaactggtgctcatggaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9063805 |
ttattaatgaagcctcaaaaaatggtttggctttaccatatacaccatattggtatggtttaacaataggtggaatgatcggaactggtgctcatggaag |
9063904 |
T |
 |
| Q |
101 |
cacattgtcggggaaaggaagtgcggttcatgactat |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9063905 |
cacattgtcggggaaaggaagtgcggttcatgactat |
9063941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 89 - 122
Target Start/End: Original strand, 9057769 - 9057802
Alignment:
| Q |
89 |
tgctcatggaagcacattgtcggggaaaggaagt |
122 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
9057769 |
tgctcatggaagcacattgtgggggaaaggaagt |
9057802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 133
Target Start/End: Complemental strand, 493789 - 493696
Alignment:
| Q |
40 |
atacaccatattggtatggtttaacaataggtggaatgatcggaactggtgctcatggaagcacattgtcggggaaaggaagtgcggttcatga |
133 |
Q |
| |
|
||||||||||||||| |||||||| || ||||| | || | |||||||| |||||||| ||||||| ||| ||||||||||| |||||||| |
|
|
| T |
493789 |
atacaccatattggtggggtttaaccattggtggcctaattagcactggtgcacatggaagtacattgtggggtaaaggaagtgctgttcatga |
493696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University