View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_107 (Length: 215)
Name: NF1254_low_107
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_107 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 38122684 - 38122627
Alignment:
| Q |
1 |
ctaaaaaatgtttagatgagatcatacaaatcttttctaacttaactaaagtcatgtg |
58 |
Q |
| |
|
|||||||||||||||||||||| |||| | |||||||||||||||||||||||||||| |
|
|
| T |
38122684 |
ctaaaaaatgtttagatgagattatacgagtcttttctaacttaactaaagtcatgtg |
38122627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University