View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1254_low_109 (Length: 208)

Name: NF1254_low_109
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1254_low_109
NF1254_low_109
[»] chr1 (1 HSPs)
chr1 (4-126)||(1864685-1864806)


Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 4 - 126
Target Start/End: Complemental strand, 1864806 - 1864685
Alignment:
4 ttttttacaatggacatttgatttaagatataaactttatcagagactagttttgggacgtatgtttggcactcttattagtcagcagtccaacaggtaa 103  Q
    |||||||| | |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||    
1864806 ttttttacgagggacttttgatttaagatataaactttatctgagactagttttgggacgtatgtttggcactcttattagtcagcagt-caataggtaa 1864708  T
104 catctaggaacattgatctgcct 126  Q
    ||| |||||||||||||||||||    
1864707 catttaggaacattgatctgcct 1864685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University