View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_37 (Length: 415)
Name: NF1254_low_37
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 24 - 323
Target Start/End: Original strand, 15292851 - 15293150
Alignment:
| Q |
24 |
aggagtatttggctttgaaaacttttgcatgaacatgagaatattgtaaaactattttgcacacgtcgctatgtatgtaacaaaatgaatcttgttgtca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15292851 |
aggagtatttggctttgaaaacttttgcatgaacatgagaatattgtaaaactattttgcacacgtcgctatgtatgtaacaaaatgaatcttgttgtca |
15292950 |
T |
|
| Q |
124 |
ttttgattacataaacttctaagaaaattttatagtaatgttacatcaaaattattctctctccttataaatacgtcacttacaatacttttttatatgg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15292951 |
ttttgattacataaacttctaagaaaattttatagtaatgttacatcaaaattattctctctccttataaatacgtcacttacaatacttttttatatgg |
15293050 |
T |
|
| Q |
224 |
gtaaaaagatgatagtttgcatttgtttatcttttcaccagctaaattgtgatagaaaggatgatggtattgttcttgttagcatatttaagttggtagg |
323 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15293051 |
gtaaaaaaatgatagtttgcatttgtttatcttttcaccagcgaaattgtgatagaaaggatgatggtattgttcttgttagcatatttaagttggtagg |
15293150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University