View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_47 (Length: 385)
Name: NF1254_low_47
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_47 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 94 - 316
Target Start/End: Original strand, 21434759 - 21434979
Alignment:
| Q |
94 |
acattttggatctatatcccataaaacaaaaaactgtctaatctttataagctttatctagaccatatctctagcaaatatcttgagggtcttattctaa |
193 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21434759 |
acattttggacctatatcccataaaacaaaaaactgtctaatctttataagctttatcta--ccatatctctagcaaatatcttgagggtcttattctaa |
21434856 |
T |
|
| Q |
194 |
tactgaattaccaaattcgcatgattgtataagtgattatatttgattttcaaaacatagaaataaaactacaaaatactctactagatcataatgcatt |
293 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21434857 |
tactaaattaccaaattcgcatgattgtataagtgattatatttgattttcaaaacatagaaataaaactacaaaatactctactagatcataatgcatt |
21434956 |
T |
|
| Q |
294 |
tactctatcacattcatattctt |
316 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
21434957 |
tactctctcacattcatattctt |
21434979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University