View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_50 (Length: 359)
Name: NF1254_low_50
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 76 - 347
Target Start/End: Complemental strand, 12268088 - 12267817
Alignment:
| Q |
76 |
agtaactaaatctaaccttcatcaaattcagagtcaaactaatgatagtgtctacaacaataatcttcttgttgaagagaaagttgtggatagaatcaaa |
175 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12268088 |
agtaactgaatacaaccttcatcaaattcagagtcaaactaatgatagtgtctacaacaataatcttcttgttgaagagaaagttgtggatagaatcaaa |
12267989 |
T |
|
| Q |
176 |
tccaaattgacaactttgaaggcctctttaatttctatagtgggaagggttcaagttattagattttaattcatagcatgagtatctatagctttgtcat |
275 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12267988 |
tccaaattgacaactttgaaggcatctttaatttctatagtgggaagggttcaagttattagattttaattcatagtatgagtatctatagctttgtcat |
12267889 |
T |
|
| Q |
276 |
ttattcattgtgtgatctgatggcattgaactggaaggaggaacaaatgatttccaaacattcttagcccta |
347 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12267888 |
ttattcattgcgtgatctgatggcattgaactggaaggaggaacaaatgatttccaaacattcttagcccta |
12267817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University