View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_53 (Length: 340)
Name: NF1254_low_53
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 4 - 242
Target Start/End: Original strand, 13591931 - 13592171
Alignment:
| Q |
4 |
taaggtagaatcatatttatccataacttccatgggtaaaaaa-tcagtaatttcttttgtaaatttataggt-aaggtggtaaaaatttctcagttttt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
13591931 |
taaggtagaatcatatttatccataacttccatgggtaaaaaaatcagtaatttcttttgcaaatttataggtcaagttggtaaaaatttctcagttttt |
13592030 |
T |
 |
| Q |
102 |
atcccgattacaattttttgtgttatctcgttgagttagtggaagtttgttgcttattgggactaaaaatttgtagaatgacataaaatacactagatgt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13592031 |
atcccgattacaattttttgtgttatctcgttgagttaatggaagtttgttgtttattggggctaaaaatttgtagaatgacataaaatacactggatgt |
13592130 |
T |
 |
| Q |
202 |
ttgataacatatttgattaatgatagtagttattctactgt |
242 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
13592131 |
ttgataacatgtttgattaatgataatagttattctactgt |
13592171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 264 - 324
Target Start/End: Original strand, 13592157 - 13592215
Alignment:
| Q |
264 |
tagttattctactgtgaatattgacacaatactcaatattttcaaccggacagattatcta |
324 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13592157 |
tagttattctactgtgaatattgaca--atactcaatattttcaaccggacagattatcta |
13592215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University