View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_54 (Length: 335)
Name: NF1254_low_54
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 110 - 191
Target Start/End: Original strand, 6913784 - 6913866
Alignment:
| Q |
110 |
ttgtggaaaaccgagttctgttacaaaaacatgattcatgagaaaagttttattagta-tttatcaacaccaacgatctctac |
191 |
Q |
| |
|
||||||||||| ||||| | ||||||||||||||||||||||||| ||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
6913784 |
ttgtggaaaactgagttattttacaaaaacatgattcatgagaaatgttgtattagtattttatcaaaaccaacgatctctac |
6913866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 46 - 85
Target Start/End: Original strand, 6913699 - 6913738
Alignment:
| Q |
46 |
ggttggaaacgagagatgttctagaaaataaaattatcag |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6913699 |
ggttggaaacgagagatgttctagaaaataaaattatcag |
6913738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University