View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_56 (Length: 334)
Name: NF1254_low_56
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_56 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 94 - 334
Target Start/End: Complemental strand, 45641798 - 45641553
Alignment:
| Q |
94 |
aagtagaggttcctgaatgtcaaggattccaattttcatccacctctttcaaaccaacagctgatcaagcagttctcaccctttcatattttaaccacaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45641798 |
aagtagaggttcctgaatgtcaaggattccaattttcatccacctctttcaaaccaacagctgatcaagcagttctcaccctttcatattttaaccacaa |
45641699 |
T |
 |
| Q |
194 |
cttaatggaccacattgctctaaatgaaaatgacaacagatattctcactatgagtttctctacatgttctgatgctattct-----tgcccctcaacta |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45641698 |
cttaatggaccacattgctctaaatgaaaatgacaacagatattctcactatgagtttctctacatgttctgatgctattcttgccttgcccctcaacta |
45641599 |
T |
 |
| Q |
289 |
aaccattttcattgaacatcccataaattcaccgcaagtgttctct |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45641598 |
aaccattttcattgaacatcccataaattcaccgcaagtgttctct |
45641553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University