View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_57 (Length: 326)
Name: NF1254_low_57
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 1 - 303
Target Start/End: Complemental strand, 31828446 - 31828144
Alignment:
| Q |
1 |
ccaccttgcaaaccaagaactcagtaagcaaacacttcccagttgtacctcagagacacccctatgctgcaaaacccacaagctgtacctctcattcctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828446 |
ccaccttgcaaaccaagaactcagtaagcaaacacttcccagttgtacctcagagacacccctatgctgcaaaacccacaagctgtacctctcattcctt |
31828347 |
T |
 |
| Q |
101 |
cctcaagttcctgattttgcttctcccatgacacctaagcgtgcaagaggacacgaccaccactgatccagttcatatttgaagattgtggattttgtta |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828346 |
ccttaagttcctgattttgcttctcccatgacacctaagagtgcaagaggacacgaccaccactgatccagttcatatttgaagattgtggattttgtta |
31828247 |
T |
 |
| Q |
201 |
accagttccaagagagtaatccgacttgatctacaatcttatcagttgagacctttttgtcctgannnnnnnnagcgtttctcgccttccaaatgctcca |
300 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31828246 |
accagttccaagagagtaatctgacttgatctacaatcttatcagtcgagacctttttgtcctgaatttttttagcgtttctcgccttccaaatgctcca |
31828147 |
T |
 |
| Q |
301 |
taa |
303 |
Q |
| |
|
||| |
|
|
| T |
31828146 |
taa |
31828144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University