View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_59 (Length: 322)
Name: NF1254_low_59
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_59 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 10598681 - 10598373
Alignment:
| Q |
1 |
accattcaaatctgcagatactttcgtttttataccggttggttctctgtcagcagtgtcttgaacatcagcttttgttgcttgctgtgcaagattttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
10598681 |
accattcaaatctgcagatactttcgtttttgtaccggttggttctctgtcagcagtgtcttgaacatcagcttttgtttcttgctgtgcaagcttttct |
10598582 |
T |
 |
| Q |
101 |
tctgattccttttcattcatcattatgatatctagatcatttgcttcttgattcccatgatcagaaatttcaagaggtggtaacttagagtcaattccaa |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10598581 |
tctggttccttttcattcatcattatgatatctagatcattcgcttcttgattcccatgatcagaaatttcaagaggtggtaacttagagtcaattccaa |
10598482 |
T |
 |
| Q |
201 |
ttcctgattcttctgtgtctattggtgtatctgctatgtgtccatcatcttctttctggaactcaatcttcacccaaccatctgattcctcactagactt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10598481 |
ttcctgattcttctgtgtctattggtgtatctgctatgtgtccatcatcttctttctggaactcaatctttacccaaccatctgattcctcactagactt |
10598382 |
T |
 |
| Q |
301 |
aacatcttc |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
10598381 |
aacatcttc |
10598373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University