View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_70 (Length: 289)
Name: NF1254_low_70
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_70 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 97 - 217
Target Start/End: Original strand, 545940 - 546061
Alignment:
| Q |
97 |
tataagaag-tttgtatgataaagaattgacttggaagaatttttctaagaatttcaaaatccaagaattgaacgtagagtaatcaagtttcaagtaaaa |
195 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
545940 |
tataagaagctttgtatgataaagaattgacttggaagaatttttctaagaatttcaaaatccaagaattgaacgtagagtaatcaagtttcaagtataa |
546039 |
T |
|
| Q |
196 |
tatcctcacacagccaaggatc |
217 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
546040 |
tatcctcacacagccaaggatc |
546061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 227 - 289
Target Start/End: Original strand, 555709 - 555771
Alignment:
| Q |
227 |
aatttgaagctaaaggatatgctcaggtctcataaagtaactcaaaatgttacaaaaagaatc |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
555709 |
aatttgaagctaaaggatatgctcaggtctcataaagtaactcaaaatgttacaaaaagaatc |
555771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 289
Target Start/End: Original strand, 558445 - 558498
Alignment:
| Q |
236 |
ctaaaggatatgctcaggtctcataaagtaactcaaaatgttacaaaaagaatc |
289 |
Q |
| |
|
|||||||| ||||||| |||| ||||| ||||||||||||| ||||||||||| |
|
|
| T |
558445 |
ctaaaggacatgctcaactctcctaaagcaactcaaaatgttgcaaaaagaatc |
558498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University