View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_72 (Length: 284)
Name: NF1254_low_72
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 29 - 276
Target Start/End: Complemental strand, 31828628 - 31828379
Alignment:
| Q |
29 |
acgatcacatactgctactcccgtttctaagtcaagacacagatagaactgcagctgcatattctgca--gtctattcactagcggagctgctcctgcaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31828628 |
acgatcacatactgctactcccgtttctaagtcaagacacagatagaactgcagctgcatattctgcacagtctattcactagcggagctgctcctgcaa |
31828529 |
T |
 |
| Q |
127 |
atgtcctgctaccagccacacaatggcgaacacgaatggacaaaacacgattagaccgtgaacaaaacctctgacacttgatccaccttgcaaaccaaga |
226 |
Q |
| |
|
| ||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828528 |
aagtcctgctacctgccacacaatggcgaatacgaatggacaaaacacgattagaccatgaacaaaacctctgacacttgatccaccttgcaaaccaaga |
31828429 |
T |
 |
| Q |
227 |
actcagtaagcaaacacttcccagttgtacctcagagacacccctatgct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828428 |
actcagtaagcaaacacttcccagttgtacctcagagacacccctatgct |
31828379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University