View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_73 (Length: 280)
Name: NF1254_low_73
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_73 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 105 - 182
Target Start/End: Original strand, 52277399 - 52277476
Alignment:
| Q |
105 |
tttgacccttcaacttgttgtcttctttcctccatcttgaggtttccgatatggtgtttggcgttcacctgcagctca |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
52277399 |
tttgacccttcaacttgttgtcttctttcctccatcttgaggtttccgatctggtgtttggtgttcacctgcagctca |
52277476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University