View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_8 (Length: 569)
Name: NF1254_low_8
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 293; Significance: 1e-164; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 163 - 515
Target Start/End: Original strand, 27249114 - 27249467
Alignment:
| Q |
163 |
ttggcaactcatctcggataggatatccactagagttgcccgagtttgttgattatctctttcttacatgtaaagttgcctctcatgttggtatatgatt |
262 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27249114 |
ttgggaactcatctcggataggatatccactatagttgcccgagtctgttgattatctctttcttacatgtaaagttggctctcatgttggtatatgatt |
27249213 |
T |
|
| Q |
263 |
tttagatggttaggatggttgcnnnnnnn-catagggattagatatgtctttttgagggggttttagggttaggtggaaaagataaggttagacatggtt |
361 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27249214 |
tttagatggttaggatggttgctttttttgcatagggattagatatgtctttttgagtgggttctagggttagctggaaaagataaggttagacatggtt |
27249313 |
T |
|
| Q |
362 |
tattgttgatctaacataccattgtgttatccatttggacaatccataactatcttttgttttctagtggatatctctatatatgtggaggaattggtca |
461 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27249314 |
tattgttgatctaacataccattgtgttatccatttggacaatccataactatcttttgttttctagtggatatctttatatatgtggaggaattggtca |
27249413 |
T |
|
| Q |
462 |
taagatcccattctcttcatggtattggtttatcaagagtcaccctggttcact |
515 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27249414 |
taagatcccattctcttcatggtattggtttatcaagagtcaccctggttcact |
27249467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 9 - 143
Target Start/End: Original strand, 27248988 - 27249122
Alignment:
| Q |
9 |
atcataggccgctgtcggttgaggattactattggtcttggaaatgttcttctcgaggggagtatatattgagttcggaggaggagtgtcatagttagca |
108 |
Q |
| |
|
|||| |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27248988 |
atcagaggccgttgtcggttgaggatttctattggtcttggaaatgttcttctcgaggggagtatatattgagttcggaggaagagtgtcatagttagca |
27249087 |
T |
|
| Q |
109 |
catttactaacaagggtgtggaagagttgggaact |
143 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27249088 |
catttactagcaagggtgtggaagagttgggaact |
27249122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 511 - 540
Target Start/End: Original strand, 27249474 - 27249503
Alignment:
| Q |
511 |
tcactatgagtgggtgatggagtaagttct |
540 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27249474 |
tcactatgagtgggtgatggagtaagttct |
27249503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University