View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254_low_96 (Length: 250)
Name: NF1254_low_96
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254_low_96 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 70 - 222
Target Start/End: Original strand, 29998878 - 29999030
Alignment:
| Q |
70 |
tccaatgtgtgccaaatattgtattcaaaaattgtgatcaaccaatactttttcaacaaggagtagataaatggagcactccttggtggtatggtgacat |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29998878 |
tccaatgtgtgccaaatattgtattcaaaaattgtgatcaaccaatactttttcaacaaggaatagataaatggagcactccttggtggtatggtgacat |
29998977 |
T |
|
| Q |
170 |
atgttgtagcttctctgtccacagaaaaacgtgtacaccaacttggagttctt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29998978 |
atgttgtagcttctctgtccacagaaaaacgtgtacaccaacttggagttctt |
29999030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University