View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1255-Insertion-3 (Length: 98)
Name: NF1255-Insertion-3
Description: NF1255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1255-Insertion-3 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 5e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 5e-19
Query Start/End: Original strand, 39 - 98
Target Start/End: Original strand, 48688020 - 48688078
Alignment:
| Q |
39 |
ttgttaacatatttgttttgacatacattttcagtttcaactttcacctcttgtaccgag |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48688020 |
ttgttaacatatttgttc-gacatacattttcagtttcaactttcacctcttgtaccgag |
48688078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 43
Target Start/End: Original strand, 48687926 - 48687961
Alignment:
| Q |
8 |
atatacactatacagttaatttgttacctttttgtt |
43 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48687926 |
atatacactatacagttaatttgttacttttttgtt |
48687961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University