View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12550_high_7 (Length: 233)
Name: NF12550_high_7
Description: NF12550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12550_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 58 - 212
Target Start/End: Complemental strand, 20582264 - 20582103
Alignment:
| Q |
58 |
gagagtttgtggtttggtgtgccaattgccacgtggccggtctatgcagagcaacaaattaatgcat-------ggttagggaattgggattagcggtgg |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |||| |
|
|
| T |
20582264 |
gagagtttgtggtttggtgtgccaattgccacgtggccggtctatgcagagcaacaaatgaatgcattccagatggttagggaattgggattagcagtgg |
20582165 |
T |
|
| Q |
151 |
agattaggctggattatagggtgggtggggatctggtgttggcagaagaagttaagaatggt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20582164 |
agattaggctggattatagggtgggtggggatctggtgttggcagaagaagttaagaatggt |
20582103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 58 - 212
Target Start/End: Complemental strand, 20563101 - 20562940
Alignment:
| Q |
58 |
gagagtttgtggtttggtgtgccaattgccacgtggccggtctatgcagagcaacaaattaatgcat-------ggttagggaattgggattagcggtgg |
150 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| || ||||| ||||||||||| ||||||| ||||||||||| |||| |||| |||| |
|
|
| T |
20563101 |
gagagtttgtggtatggtgtgccaattgccacgtggccagtttatgcggagcaacaaatgaatgcattcgagatggttagggaatcgggactagccgtgg |
20563002 |
T |
|
| Q |
151 |
agattaggctggattatagggtgggtggggatctggtgttggcagaagaagttaagaatggt |
212 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||| |||||||||||| ||||||||| |
|
|
| T |
20563001 |
agattaggttggattatagggtgggtggggatttggtgcaggcagaagaagtcaagaatggt |
20562940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 58 - 212
Target Start/End: Complemental strand, 17781919 - 17781758
Alignment:
| Q |
58 |
gagagtttgtggtttggtgtgccaattgccacgtggccggtctatgcagagcaacaaattaatgc-------atggttagggaattgggattagcggtgg |
150 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||| ||||||||||||||||| || || |||||||| |||||||||||||| |||| |
|
|
| T |
17781919 |
gagagtttgtggtatggtgtgccaattgctacgtggccggtgtatgcagagcaacaaatgaacgcgtttcaaatggttagagaattgggattagcagtgg |
17781820 |
T |
|
| Q |
151 |
agattaggctggattatagggtgggtggggatctggtgttggcagaagaagttaagaatggt |
212 |
Q |
| |
|
|||||||| |||||||| | |||||||| ||| |||| ||||||||||||| | |||||| |
|
|
| T |
17781819 |
agattaggttggattatcgtgtgggtggagatttggtacaggcagaagaagttgaaaatggt |
17781758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University