View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12550_low_10 (Length: 233)

Name: NF12550_low_10
Description: NF12550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12550_low_10
NF12550_low_10
[»] chr2 (3 HSPs)
chr2 (58-212)||(20582103-20582264)
chr2 (58-212)||(20562940-20563101)
chr2 (58-212)||(17781758-17781919)


Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 58 - 212
Target Start/End: Complemental strand, 20582264 - 20582103
Alignment:
58 gagagtttgtggtttggtgtgccaattgccacgtggccggtctatgcagagcaacaaattaatgcat-------ggttagggaattgggattagcggtgg 150  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||       ||||||||||||||||||||| ||||    
20582264 gagagtttgtggtttggtgtgccaattgccacgtggccggtctatgcagagcaacaaatgaatgcattccagatggttagggaattgggattagcagtgg 20582165  T
151 agattaggctggattatagggtgggtggggatctggtgttggcagaagaagttaagaatggt 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20582164 agattaggctggattatagggtgggtggggatctggtgttggcagaagaagttaagaatggt 20582103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 58 - 212
Target Start/End: Complemental strand, 20563101 - 20562940
Alignment:
58 gagagtttgtggtttggtgtgccaattgccacgtggccggtctatgcagagcaacaaattaatgcat-------ggttagggaattgggattagcggtgg 150  Q
    ||||||||||||| |||||||||||||||||||||||| || ||||| ||||||||||| |||||||       ||||||||||| |||| |||| ||||    
20563101 gagagtttgtggtatggtgtgccaattgccacgtggccagtttatgcggagcaacaaatgaatgcattcgagatggttagggaatcgggactagccgtgg 20563002  T
151 agattaggctggattatagggtgggtggggatctggtgttggcagaagaagttaagaatggt 212  Q
    |||||||| ||||||||||||||||||||||| |||||  |||||||||||| |||||||||    
20563001 agattaggttggattatagggtgggtggggatttggtgcaggcagaagaagtcaagaatggt 20562940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 58 - 212
Target Start/End: Complemental strand, 17781919 - 17781758
Alignment:
58 gagagtttgtggtttggtgtgccaattgccacgtggccggtctatgcagagcaacaaattaatgc-------atggttagggaattgggattagcggtgg 150  Q
    ||||||||||||| ||||||||||||||| ||||||||||| ||||||||||||||||| || ||       |||||||| |||||||||||||| ||||    
17781919 gagagtttgtggtatggtgtgccaattgctacgtggccggtgtatgcagagcaacaaatgaacgcgtttcaaatggttagagaattgggattagcagtgg 17781820  T
151 agattaggctggattatagggtgggtggggatctggtgttggcagaagaagttaagaatggt 212  Q
    |||||||| |||||||| | |||||||| ||| ||||   ||||||||||||| | ||||||    
17781819 agattaggttggattatcgtgtgggtggagatttggtacaggcagaagaagttgaaaatggt 17781758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University