View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12550_low_8 (Length: 257)
Name: NF12550_low_8
Description: NF12550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12550_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 6099287 - 6099512
Alignment:
| Q |
18 |
catttgacagtagctcctcgggggtattatattcaagaacctttcaaatataaaattacgcatcagtgcagagcatcaaatcaaacgtcagtttaggggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
6099287 |
catttgacagtagctcctcgggggtattatattcaagaacctttcaaatataaaataacacatcagtgcagagcatcgaatcaaacgtcagtttatgggt |
6099386 |
T |
|
| Q |
118 |
ttagattcaaattttgggcatttctgcatttgtaacaattacttgttcaaattttcaatttttcttactaaaacttccgatgatatttttattgaagaag |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6099387 |
ttagattcaaattttgggcctttctgcatttgtaacaattacttgttcaaattttcaatttttcttactaaaacttccgatgatatttttattgaagaag |
6099486 |
T |
|
| Q |
218 |
ccaaactagcccaccgatattggcag |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6099487 |
ccaaactagcccaccgatattggcag |
6099512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 204 - 242
Target Start/End: Original strand, 48125129 - 48125167
Alignment:
| Q |
204 |
ttttattgaagaagccaaactagcccaccgatattggca |
242 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
48125129 |
tttttttgaagaagccaaactagcccaccgaaattggca |
48125167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 238
Target Start/End: Complemental strand, 43303874 - 43303845
Alignment:
| Q |
209 |
ttgaagaagccaaactagcccaccgatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43303874 |
ttgaagaagccaaactagcccaccgatatt |
43303845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 239
Target Start/End: Complemental strand, 38939324 - 38939288
Alignment:
| Q |
203 |
tttttattgaagaagccaaactagcccaccgatattg |
239 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
38939324 |
ttttttttgaagaagccaaactagcccaccgaaattg |
38939288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University