View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12551_high_17 (Length: 357)
Name: NF12551_high_17
Description: NF12551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12551_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 10 - 347
Target Start/End: Original strand, 5438810 - 5439147
Alignment:
| Q |
10 |
gttcactgcaggttacaaggcatgaaattagagatagaaaagccgttggaaccatgcccgaagcttatccacatattattcttgataattttgaaactaa |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5438810 |
gttcattgcaggttacaaggcatgaaattagagatagaaaagccgttggaaccatgcccgaagcttatccgcatattattcttgataattttgaaactaa |
5438909 |
T |
 |
| Q |
110 |
ggtattcatatttcaatatgagcttcatcatctttgtacgtactaattttactggcaatggtctgtttctttcactccttatttattcgaccttctgata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5438910 |
ggtattcatatttcaatatgagcttcatcatctttgtacgtactaattttactggcaatggtctgtttctttcactacttatttattcgaccttctgata |
5439009 |
T |
 |
| Q |
210 |
atttttggtctttcagtatcattggttcatatctttatcaaaatatggaatgatgtcagaaccctttttgcagtatttaaaacaagttgcatagttgtaa |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5439010 |
atttttggtctttcagtatcattggttcatatctttatcaaaatatggaatgatgtcagaaccctttttgcagtatttaaaacaagttgcatagttgtaa |
5439109 |
T |
 |
| Q |
310 |
gtaaaattaaacaatgtaggttgcaccgtgatgtccat |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5439110 |
gtaaaattaaacaatgtaggttgcaccgtgatgtccat |
5439147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University