View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12551_high_24 (Length: 291)
Name: NF12551_high_24
Description: NF12551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12551_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 27 - 219
Target Start/End: Original strand, 7291900 - 7292091
Alignment:
| Q |
27 |
cttcttctgtgattttagggtttcatagcttcgtcgtgcatcagattttgatgtttgtaattctaatcgtcttaaatcttaatagacagacttatatagt |
126 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7291900 |
cttcttctgttattttagggtttcatagcttcgtcgtgcatcagattttgatgtttgtaattctaatcgtcttaaatcttaatagacagacttatatagt |
7291999 |
T |
 |
| Q |
127 |
ctttcttctttaggaaggtctaataggctaatatagaagtaactagaagaatgaatgaaaataatgcataaattcttttcccacaatccaaaa |
219 |
Q |
| |
|
|||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7292000 |
cttt-ttttttaggaaggtctaataggctaatatagaagtaactagaagaatgaatgaaaataatgcataaattcttttcccacgctccaaaa |
7292091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University