View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12551_low_15 (Length: 365)
Name: NF12551_low_15
Description: NF12551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12551_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 7e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 18 - 151
Target Start/End: Complemental strand, 38213832 - 38213699
Alignment:
| Q |
18 |
acaacagccatattggccatgctctatacaatttttgttgcattcgttcttgatgcattgtgtaatcacaattttttgctgcgcagaatcataaacttta |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38213832 |
acaacatccatattggccatgctctatacaatttttgttgcattctttcttgatgcattgtgtaatcacaattttttgctgcgcagaatcataaacttta |
38213733 |
T |
 |
| Q |
118 |
tgctcgatcactgtcctaccatttgcactgcacc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38213732 |
tgctcgatcactgtcctaccatttgcactgcacc |
38213699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 204 - 347
Target Start/End: Complemental strand, 38213645 - 38213502
Alignment:
| Q |
204 |
tggcacataatgaaagaaggagcaaatagcttagtcnnnnnnngctttatttaccatagccacattacgaagagagtaagaataactagagaaacgatat |
303 |
Q |
| |
|
||||||||| ||| |||||||||||||||||| ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38213645 |
tggcacatagtgatagaaggagcaaatagctttgtcaaaaaaagctttacttaccatagccacattacgaagagagtaagaataactagagaaacgatat |
38213546 |
T |
 |
| Q |
304 |
tttgatttctcattttcttaacttgaaattgttggttgtagtct |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38213545 |
tttgatttctcattttcttaacttgaaattgttcgttgtagtct |
38213502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University