View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12551_low_25 (Length: 307)
Name: NF12551_low_25
Description: NF12551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12551_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 17 - 296
Target Start/End: Complemental strand, 6472058 - 6471779
Alignment:
| Q |
17 |
atttggaggggtcaggaagaacagtggattgtatctgtgggaatagaaaggaactattctctttgttgttaggcattgcagctgataggataatgatgaa |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6472058 |
atttggaggggtcagggagaacagtggattgtatctgtgggaatagaaaggaactattctctttgttgttaggcattgcagctgataggataatgatgaa |
6471959 |
T |
|
| Q |
117 |
tgtcttaattattattgtggttttatagttttttaaggtatgtggtgagtgcaatttgtgtgttagattcttagtattttcagcattggatactactcaa |
216 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6471958 |
tgtcttaattatgattgtggttttatagttttttaaggtatgtggtgagtgcaatttttgtgttagattcttagtattttcagcattagatactactcaa |
6471859 |
T |
|
| Q |
217 |
tcttaggcaagttttagggtacacgataggctaatacttgaaaatttctcaaaacaccaatgacaattaacctacccttt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6471858 |
tcttaggcaagttttagggtacacgataggctaatacttgaaaatttctcaaaacatcaatgacaattaacctacccttt |
6471779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 205 - 286
Target Start/End: Complemental strand, 13035011 - 13034930
Alignment:
| Q |
205 |
gatactactcaatcttaggcaagttttagggtacacgataggctaatacttgaaaatttctcaaaacaccaatgacaattaa |
286 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13035011 |
gatacaactcaatcttaggcaagttttacggtacacgataggctaatacttaaaaatttctcaaaacaccaatgacaattaa |
13034930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University