View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12551_low_29 (Length: 272)
Name: NF12551_low_29
Description: NF12551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12551_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 42303265 - 42303007
Alignment:
| Q |
1 |
ataataaactctatgatatactaatttatacacccactcatttttagtagatctagacccataaaccctaaaccgtaattattactaaaattttgtcgat |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42303265 |
ataataaactctaggatatactaatttatacacccactcatttttagtagatctagacccataaaccctaaaccgtaattattactgaaattttgtcgat |
42303166 |
T |
 |
| Q |
101 |
tgtacttgaaggtgtgacttataaatctatacgaattaaaaaggg-taaatttgcaaactcatacacatcaaagcttactaaaaaagtggaatctatgag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42303165 |
tgtacttgaaggtgtgacttataaatctatccgaattaaaaagggttaaatttgcaaactcatacacataaaagcttactaaaaaagtggaatctatgag |
42303066 |
T |
 |
| Q |
200 |
aacattcttttaagatatcagcagtctcacgaacacattgctactatccaacttcttct |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42303065 |
aacattcttttaagatatcagcagtctcacgaacacattgctactatccaacttcttct |
42303007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University