View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12551_low_35 (Length: 240)
Name: NF12551_low_35
Description: NF12551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12551_low_35 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 5174141 - 5174358
Alignment:
| Q |
18 |
agaatgtccaaactaaagattaaaacgtcaccactcactcaccaaggacacaaaatttgtggtaagaatgtagcattgcattacaggttcatattcattt |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174141 |
agaatgtccaaactaa-gattaaaacgtcaccactcactcaccaaggacacaaaatttgtggtaagaatgtagcattgcattacaggttcatattcattt |
5174239 |
T |
|
| Q |
118 |
ttcagaacagcccataaccaacgctcgcccacaaatatcaatannnnnnnnngggaaactcagatgcaacttagtttttgaataaactatataatactaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174240 |
ttcagaacagcccataaccaacgctcgcccacaaatatcaata----tttttgggaaactcagatgcaacttagtttttgaataaactatataatactaa |
5174335 |
T |
|
| Q |
218 |
tttgttatgcttggaatgtttat |
240 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
5174336 |
tttgttatgcttggactgtttat |
5174358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University