View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12551_low_37 (Length: 231)
Name: NF12551_low_37
Description: NF12551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12551_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 47 - 213
Target Start/End: Original strand, 25271630 - 25271791
Alignment:
| Q |
47 |
tgaaacaataaagtaggctcaacctttgaacaaaaatcatcaatttcaacactagtccaaaataaaaacagaacaactaatcaacaccacgtcctttcct |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
25271630 |
tgaaacaataaagtaggctcaacctttgaacaaaaatcatcagattcaacacaagtccaaaatgaaaacagaacaactaatcaacaccacgtgctttccc |
25271729 |
T |
|
| Q |
147 |
tgattttgatttcataaactcaattcaaattcaattcaattcaattctgactttgttgttgtccatg |
213 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||| |||||||||||||||||||| |
|
|
| T |
25271730 |
tgattttgatttcataaactcaatgca-----aattcaattcaattatgactttgttgttgtccatg |
25271791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University