View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12551_low_37 (Length: 231)

Name: NF12551_low_37
Description: NF12551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12551_low_37
NF12551_low_37
[»] chr7 (1 HSPs)
chr7 (47-213)||(25271630-25271791)


Alignment Details
Target: chr7 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 47 - 213
Target Start/End: Original strand, 25271630 - 25271791
Alignment:
47 tgaaacaataaagtaggctcaacctttgaacaaaaatcatcaatttcaacactagtccaaaataaaaacagaacaactaatcaacaccacgtcctttcct 146  Q
    ||||||||||||||||||||||||||||||||||||||||||  |||||||| |||||||||| |||||||||||||||||||||||||||| ||||||     
25271630 tgaaacaataaagtaggctcaacctttgaacaaaaatcatcagattcaacacaagtccaaaatgaaaacagaacaactaatcaacaccacgtgctttccc 25271729  T
147 tgattttgatttcataaactcaattcaaattcaattcaattcaattctgactttgttgttgtccatg 213  Q
    |||||||||||||||||||||||| ||     |||||||||||||| ||||||||||||||||||||    
25271730 tgattttgatttcataaactcaatgca-----aattcaattcaattatgactttgttgttgtccatg 25271791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University