View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12551_low_39 (Length: 217)
Name: NF12551_low_39
Description: NF12551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12551_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 34380900 - 34380698
Alignment:
| Q |
1 |
atggtcctcgacacagggagtgaactctcatggcttcattgcaaaaaactccctaacctaaacttcagtttcaacccacttgtttcttcttcatacacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34380900 |
atggtcctcgacacagggagtgaactctcatggcttcattgcaaaaaactccctaacctaaacttcattttcaacccacttgtttcttcttcatacaccc |
34380801 |
T |
 |
| Q |
101 |
ccactccatgcacctcccctatctgcacgactcaaactcgagatctaatcaatcctgtttcatgtgatacaaacaaactttgccacgttatcgtctccta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
34380800 |
ccactccatgcacctcccctatctgcacgactcaaactcgagatctaatcaatcctgtttcatgtgatgcaaacaaactttgccacattatcgtctccta |
34380701 |
T |
 |
| Q |
201 |
tgc |
203 |
Q |
| |
|
||| |
|
|
| T |
34380700 |
tgc |
34380698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 30635079 - 30634964
Alignment:
| Q |
1 |
atggtcctcgacacagggagtgaactctcatggcttcattgcaaaaaactccctaacctaaacttcagtttcaacccacttgtttcttcttcatacacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||| || ||||||||| || |||||||||| |||||| |
|
|
| T |
30635079 |
atggtcctcgacacagggagtgaactctcatggcttcattgcaaaaaacttccaaatttaaactccattttcaaccctctactttcttcttcttacaccc |
30634980 |
T |
 |
| Q |
101 |
ccactccatgcacctc |
116 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
30634979 |
ccaccccatgcacctc |
30634964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University