View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12551_low_40 (Length: 211)
Name: NF12551_low_40
Description: NF12551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12551_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 3e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 12 - 131
Target Start/End: Original strand, 27145702 - 27145821
Alignment:
| Q |
12 |
agatgaaaatatgatggtgtgcattgttttatcccaaagtttcctacctgcactactttgtgatgatttctctgcataagaggtcttttaccaaactcaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27145702 |
agatgaaaatatgatggtgtgcattgttttatcccaaagtttcctacctgcactactttgtgatgatttctcagcataagaggtcttttaccaaactcaa |
27145801 |
T |
 |
| Q |
112 |
acaacactaaatttacattt |
131 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27145802 |
acaacactaaatttacattt |
27145821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 195
Target Start/End: Original strand, 27145844 - 27145879
Alignment:
| Q |
160 |
gaactagtaaagacgttgatcaaccttacaagaaat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27145844 |
gaactagtaaagacgttgatcaaccttacaagaaat |
27145879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University