View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12552_high_11 (Length: 336)
Name: NF12552_high_11
Description: NF12552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12552_high_11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 264
Target Start/End: Original strand, 2265196 - 2265444
Alignment:
| Q |
17 |
atagtttctataaatcaatcttttcataaagcttatatgacaaaataacatgtctctaaaatgtcaaaataatattttgtccaccaaacatagatcatac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265196 |
atagtttctataaatcaatcttttcataaagcttatatgacaaaataacatgtctctaaaatgtcaaaataatattttgtccaccaaacatagatcatac |
2265295 |
T |
|
| Q |
117 |
aacataaaaagttgctcaatactttaaaggtttgtcatatgttgttttgtatgatattattgtgtcccgtatttac-ttttagtatatcaaacacacctt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
2265296 |
aacataaaaagttgctcaatactttaaaggtttgtcatatgttgttttgtatgatattattgtgttccgtatttactttttagtatatcaaacacacctt |
2265395 |
T |
|
| Q |
216 |
tttccttcacgggtttctaattagttctaataacttggtcttttggtat |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
2265396 |
tttccttcacgggtttctaattagttctaataacttgatcttttagtat |
2265444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 336
Target Start/End: Complemental strand, 30778295 - 30778252
Alignment:
| Q |
295 |
gacaactttctctctcat--tcacattatacttttattatctct |
336 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
30778295 |
gacaactttctctctcatactcacattatactcttattatctct |
30778252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 336
Target Start/End: Complemental strand, 37843463 - 37843420
Alignment:
| Q |
295 |
gacaactttctctctcat--tcacattatacttttattatctct |
336 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
37843463 |
gacaactttctctctcatactcacattatactcttattatctct |
37843420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 336
Target Start/End: Original strand, 49453520 - 49453563
Alignment:
| Q |
295 |
gacaactttctctctcat--tcacattatacttttattatctct |
336 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
49453520 |
gacaactttctctctcatactcacattatacttttattctctct |
49453563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University