View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12552_high_14 (Length: 292)
Name: NF12552_high_14
Description: NF12552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12552_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 2265500 - 2265653
Alignment:
| Q |
1 |
catcataatttaataaaagctatactctatagcttttgcgaaatcataatggatcaccgaccatgattttgagaaaccctcggcttctttataattgtag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265500 |
catcataatttaataaaagctatactctatagcttttgcgaaatcataatggatcaccgaccatgattttgagaaaccctcggcttctttataattgtag |
2265599 |
T |
 |
| Q |
101 |
ttcttgcagaattatttgttcttatctattaaccttaaaacgtcaaagcttctt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265600 |
ttcttgcagaattatttgttcttatctattaaccttaaaacgtcaaagcttctt |
2265653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 165 - 284
Target Start/End: Original strand, 2265691 - 2265810
Alignment:
| Q |
165 |
cgtcaaaggaatatagagaaattaaagtaataaatattacctatctccaactaggtcgtacatcctgcgaatgagatcctcctcttgctcgctcatctct |
264 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265691 |
cgtcaaaggaatatagagaaattaaaggaataaatattacctatctccaactaggtcgtacatcctgcgaatgagatcctcctcttgctcgctcatctct |
2265790 |
T |
 |
| Q |
265 |
atgaactcccactctgtgct |
284 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
2265791 |
atgaactcccactcagtgct |
2265810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University