View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12552_high_17 (Length: 265)
Name: NF12552_high_17
Description: NF12552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12552_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 11 - 248
Target Start/End: Original strand, 4315626 - 4315863
Alignment:
| Q |
11 |
cacagagttcaccggtgagttgaacatcaccggaaaaaccataaggaacaattgtgcctccaaagcggttatcaccaccagagccagacgagttacagct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4315626 |
cacagagttcaccggtgagttgaacatcaccggaaaaaccataaggaacaattgtgcctccaaagcggttatcaccaccagagccagacgagttacagct |
4315725 |
T |
|
| Q |
111 |
gtcaacagcggtgacattggaagagtcggtggaatttccggcgacattgttatcgaagaaaccgtcagacataatcacatcagcatttgaaaaatcaagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4315726 |
gtcaacagcggtgacattggaagagtcggtggaatttccggcgacattgttatcgaagaaaccgtcagacataatcacatcagcatttgaaaaatcaagt |
4315825 |
T |
|
| Q |
211 |
aaatcatcaatggcgaaaggctcacacggtggtttctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4315826 |
aaatcatcaatggcgaaaggctcacacggtggtttctg |
4315863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University