View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12552_high_20 (Length: 238)
Name: NF12552_high_20
Description: NF12552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12552_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 935178 - 934955
Alignment:
| Q |
1 |
ttgagaaggtgagtattgatgcagttgttgctgttcctgctcctgttgaggtggaatcgattgatggcttggaaggcaagaaaaggtgtgcttgggttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
935178 |
ttgagaaggtgagtattgatgcagttgttgctgttcctgctcctgttgaggtggaatcgattgatggcttggaaggcaagaaaaggtgtgcttgggttac |
935079 |
T |
 |
| Q |
101 |
accaaatacaggtatcttcattcctttgtaatcatgattaacttagaatattgtgatttgtgatattggtattatttgtttgaacttttaatttaattgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
935078 |
accaaatacaggtatcttcattcctttgtaatcatgattaacttagaatattgtgatttgtgatattggtattatttgtttgaacttttaatgtaattgt |
934979 |
T |
 |
| Q |
201 |
aaggttgaattgtaacttgtaatt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
934978 |
aaggttgaattgtaacttgtaatt |
934955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University