View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12552_high_26 (Length: 218)
Name: NF12552_high_26
Description: NF12552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12552_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 8 - 208
Target Start/End: Original strand, 935229 - 935429
Alignment:
| Q |
8 |
gacgagccgccactcctaaaagccgaagaatctgccgatgaagcacccgacgaacacgaagcattcatcgccatattctccatccccacacccccacaat |
107 |
Q |
| |
|
|||||| ||||||| ||| ||||||||||||||| |||||||||| |||||||||||||||||||||||| |||||||| |||||||||| ||||||||| |
|
|
| T |
935229 |
gacgaggcgccactactacaagccgaagaatctgtcgatgaagcatccgacgaacacgaagcattcatcgacatattcttcatccccacaaccccacaat |
935328 |
T |
 |
| Q |
108 |
gaccccgccgcttcaaaaccgccggtgtgaccaccacacactgcggcgaagttttcttcttctccgtttcgggcgccggcaccggtttcttcacattctt |
207 |
Q |
| |
|
|| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
935329 |
gatcccgccgcttcaaaaccgccggtgtaaccaccacacactgcggcgaagttttcttcttctccgtttcgggcgccggcaccggtttcttcacattctt |
935428 |
T |
 |
| Q |
208 |
c |
208 |
Q |
| |
|
| |
|
|
| T |
935429 |
c |
935429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University