View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12552_low_16 (Length: 281)
Name: NF12552_low_16
Description: NF12552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12552_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 9e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 24391504 - 24391353
Alignment:
| Q |
1 |
tgtttcatgaaaggaacaaccattagaatttagacccctgaaaccttttgcaatacgtttagacacatttatactttcaaaccatatgcctatttgattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24391504 |
tgtttcatgaaaggaacaaccattagaatttagacccctgaaaccttttgcaatacgtttagacacatttatactttcaaaccatatgcctatttgattt |
24391405 |
T |
|
| Q |
101 |
ttcaattacggtatgtattctatcccttaaatatttatttgaaataaatttt |
152 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24391404 |
ttcgattacggtatgtattctatcccttaaatatttatttgaaataattttt |
24391353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 137 - 260
Target Start/End: Complemental strand, 24391334 - 24391211
Alignment:
| Q |
137 |
atttgaaataaattttaaagtagttactacaggataaatgaatttccaaaacttataaaaacaaaaggaggtaatacttgcgttggtttgtatattaacg |
236 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24391334 |
atttgaaataaaatttaaagtagttactacaggataaatgaatttccaaaacttataaaaacaaaaggaggtaatacttgcgttggtttgtatattaacg |
24391235 |
T |
|
| Q |
237 |
ttggtataccacataccaccactg |
260 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24391234 |
ttggtataccacataccaccactg |
24391211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University