View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12552_low_22 (Length: 238)
Name: NF12552_low_22
Description: NF12552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12552_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 150 - 215
Target Start/End: Original strand, 27244144 - 27244209
Alignment:
| Q |
150 |
cgaaaatgttgtatttaacgaaaataatttcgtgaaagatagcaaacaaatgtattgttactatag |
215 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27244144 |
cgaaaatgttgtatataacgaaaataatttcgtgaaagatagcgaacaaatgtattgttactatag |
27244209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 20 - 54
Target Start/End: Original strand, 27244012 - 27244046
Alignment:
| Q |
20 |
aatcattggttaattcatctgcttagtgtttatga |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
27244012 |
aatcattggttaattcatctgcttagtgtttatga |
27244046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University