View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12552_low_23 (Length: 238)
Name: NF12552_low_23
Description: NF12552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12552_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 7666864 - 7666643
Alignment:
| Q |
1 |
cgtcatgctttgaaagtagaagcgcacgaacttcctcgttcttaaggctaaaacaattatttgatctgtgtgggctcgacaaaaacaaattaaagcacat |
100 |
Q |
| |
|
|||||| |||||||||||||||| || | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7666864 |
cgtcatcctttgaaagtagaagcacatggacttcctcgttcttaaggctaaaacaattattagatctgtgtgggctcgacaaaaacaaaataaagcacat |
7666765 |
T |
 |
| Q |
101 |
tcattttcttttatttgtactgaactaccactagttaagtcaccgtttcggccacaccggcaagagcgaccgtaaacttataatttcggaaggtgacata |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7666764 |
tcgttttcttttatttgtactgaactaccactagttaagtcaccgtttcggccacaccggcaagaacgaccgtaaacttataatttcggaaggtgacata |
7666665 |
T |
 |
| Q |
201 |
tgccgtggttagagattcaaac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7666664 |
tgccgtggttagagattcaaac |
7666643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University