View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12552_low_25 (Length: 232)
Name: NF12552_low_25
Description: NF12552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12552_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 2842030 - 2841835
Alignment:
| Q |
16 |
agaagaacaacaaatatgtgtgtttgacacgaatctacaaatacaaattctgtttgtgtacaaaatcagatagtagtggattgtaattatagttgaggta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2842030 |
agaagaacaacaaatatgtgtgtttgacacgaatctacaaatacaaattctgtttgtgtacaaaatcagatagtagtggattgtaattatagttgaggta |
2841931 |
T |
 |
| Q |
116 |
aaacctgtcttgacagtagagctttcaagaaagttaataatttcaatttcttttcagcttagcttcttttcacatctatatttcatagcattatgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2841930 |
aaacctgtcttgacagtagagctttcaagaaagttaataatttcaatttcttttcagcttagcttcttttcacatctatatttcatagcattatgt |
2841835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University