View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12553_high_5 (Length: 255)
Name: NF12553_high_5
Description: NF12553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12553_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 167 - 236
Target Start/End: Original strand, 11343793 - 11343863
Alignment:
| Q |
167 |
gccacatgtcacgcagctaagagttggg-taaatggaggtttcataaatggagggaagatgaattccatat |
236 |
Q |
| |
|
|||||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11343793 |
gccacatgtcacccatataagagttggggtaaatggaggtttcataaatggagggaagatgaactccatat |
11343863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 63 - 105
Target Start/End: Original strand, 11343689 - 11343731
Alignment:
| Q |
63 |
gtcgtgtgaagtttgaaccagaagagtaagtgcgtgtgacttc |
105 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
11343689 |
gtcgtgtgaagtttgaactagaagagtaagtgcgtgtggcttc |
11343731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University