View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12553_high_5 (Length: 255)

Name: NF12553_high_5
Description: NF12553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12553_high_5
NF12553_high_5
[»] chr5 (2 HSPs)
chr5 (167-236)||(11343793-11343863)
chr5 (63-105)||(11343689-11343731)


Alignment Details
Target: chr5 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 167 - 236
Target Start/End: Original strand, 11343793 - 11343863
Alignment:
167 gccacatgtcacgcagctaagagttggg-taaatggaggtttcataaatggagggaagatgaattccatat 236  Q
    |||||||||||| ||  ||||||||||| |||||||||||||||||||||||||||||||||| |||||||    
11343793 gccacatgtcacccatataagagttggggtaaatggaggtttcataaatggagggaagatgaactccatat 11343863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 63 - 105
Target Start/End: Original strand, 11343689 - 11343731
Alignment:
63 gtcgtgtgaagtttgaaccagaagagtaagtgcgtgtgacttc 105  Q
    |||||||||||||||||| ||||||||||||||||||| ||||    
11343689 gtcgtgtgaagtttgaactagaagagtaagtgcgtgtggcttc 11343731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University