View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12553_high_6 (Length: 250)
Name: NF12553_high_6
Description: NF12553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12553_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 33 - 241
Target Start/End: Complemental strand, 40235041 - 40234832
Alignment:
| Q |
33 |
gtaacattggagcattgttagatgagtaattagctcatttt-cttaagcttagggtgaggaactagtcttatttcttttaacctctattttgtgacccta |
131 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40235041 |
gtaacatcggagcattgttagatgagtaattagctcatttttcttaagcttagggtgaggaactagtcttatttcttttaacctctattttgtgacccta |
40234942 |
T |
|
| Q |
132 |
aacaaacttttacaactattaaatgttttccttccttcatgtgcttatggtatcactcttggcttttgtagtatattttaaagaatgtcgttaaggattt |
231 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40234941 |
aacaaacttttacaactattacatgttttccttccttcatgtgcttatggtatcactcttggcttttgtagtatattttaaagaatgtcgttaaggattt |
40234842 |
T |
|
| Q |
232 |
ctgcctttgc |
241 |
Q |
| |
|
|||||||||| |
|
|
| T |
40234841 |
ctgcctttgc |
40234832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University