View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12553_high_7 (Length: 229)
Name: NF12553_high_7
Description: NF12553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12553_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 1249232 - 1249442
Alignment:
| Q |
1 |
gggtttgatccgtcgtggtttgagaataataagtgtttatgtggtgctcccttggccccttgcaaggcctagttaactaaagggatgcatgcttaataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1249232 |
gggtttgatccgtcgtggtttgagaataataagtgtttatgtggtgctcccttggccccttgcaagacctagttaactaaagggatgcatgcttaataaa |
1249331 |
T |
|
| Q |
101 |
tggacttcatgtattattgtgctcttgtttatgcatggagttaagagaaatgcaatctaattataattagtatggatagtctacatgttttaagtacgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1249332 |
tggacttcatgtattattgtgctcttgtttatgcatggagttaagagaaatgcaatctaattataattagtatggatagtct--atgttttaagtacgtt |
1249429 |
T |
|
| Q |
201 |
ctcatcttcttaa |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1249430 |
ctcatcttcttaa |
1249442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University